Chapter 55 - 53, 4th Generation, Breakthrough!
Chapter 55 - 53, 4th Generation, Breakthrough!
The cyclization of the target pheromone proceeded very smoothly, but Xu Yun did not relax in the slightest because of this.
The usage time for this bio-medicine laboratory is fourteen days. Although on the surface, as long as the research team solves the synthesis of the Fourth Generation Imidacloprid within this time, it can be considered a success.
But as mentioned before, Xu Yun’s ultimate goal is far more than just a Fourth Generation.
Due to the large amount of equipment needed for this experiment, the entire project was initiated under the name of Tian Liangwei’s subsidiary project from the start.
Once the time limit is up, even Tian Liangwei would find it hard to provide such good experimental conditions for Xu Yun again.
Thus, this can be said to be Xu Yun’s best opportunity at present. Once missed, at the least the research and development of the Fifth Generation Imidacloprid would be delayed, at worst it could affect key points of knowledge and the opening of time-space dungeons.
So after completing the cyclization of the target pheromone, Xu Yun and others did not slack off at all, continuing with a 12-hour stirring reaction.
And at dawn the next day, performed a quenching reaction with a saturated NH4Cl solution under an ice bath cooling.
At this step, what’s left is the synthesis step of combining the pheromone-binding protein with Imidacloprid, which is also the main focus for several biology graduate students.
In layman’s terms, this step is like endlessly relying on luck, with the cyclized pheromone-binding protein being like an iron ring. For simplicity’s sake, let’s assume it’s divided into twelve sections like a clock face.
What Xu Yun and others need to do is drop a small steel ball from above. As they’ve already performed cyclization treatment from the 9 to 12 o’clock direction, the landing point of the steel ball is bound to be between 9 and 12.
But this scale is far from precise; the steel ball must land precisely on the number 46 for Xu Yun and their synthesis to be considered successful—note that this is just a macro perspective for better understanding, in reality, the scale numbers of the disk are much greater than 12 by countless times, for instance...
"22440484 pairs!"
In the laboratory, Zhou Peiyao looked at the numbers sequenced from the IlluminaHiSeq high-throughput second-generation sequencing platform and calmly said to Xu Yun:
"Senior, we have studied the binding capabilities of two OBPs with the target pheromone through a small molecule fluorescence competitive binding experiment, amounting to approximately 6.6 G of base data, with post-filtering reads showing 22440484.
The alignment consistency of the target pheromone with the American cockroach sample genome is about 84.62%, with the German cockroach being 83.68%, and the theoretical value of the binding site reads is 648!"
compared to 648, a 1 in 35,000 chance, is certainly not a simple matter.
Upon hearing this number, Xu Yun nodded lightly and turned to look at Qiu Sheng:
"Old Qiu, it’s up to the two of us now."
Qiu Sheng clapped him on the shoulder, laughed, and said:
"No need to say more, just grind it out. At worst, we can sacrifice this head of luscious hair, my friend."
Saying this, he put on a serious expression, picked up a paper strip similar to a supermarket receipt, and glanced at it:
"19.10 and 19.36kDa, the position of the protein electrophoresis bands matches the predicted molecular weights. Xiaoren, proceed directly with the fluorescence competitive binding experiment.
Let’s aim to measure the binding ability of 3,11-dimethyl-nonacosan-2-one and the target pheromone within three hours, that way we’ll have things much easier."
Standing beside him, Ren Yongcun adjusted his glasses, skillfully combining two pre-prepared reagents together.
Xu Yun then stood at the ultra-clean bench with ventilation, adding the precisely measured 1μg of target pheromone, 4μg of Anchored Oligo, 10μl of 2×ESReaction Mix, 1μl of gDNARemover, and finally RNase-free Water, bringing the mixed liquid volume to 20μl.
He then gently flicked the 20μl mixture to blend it evenly, and handed it to Zhou Peiyao:
"Xiaozhou, set to 42°C, incubate in the PCR machine for 15 minutes, then heat at 85°C for 5 seconds.
Afterwards, quantify the synthesized cDNA template, determine its eligibility with 1.2% agarose gel electrophoresis, and store it in an environment at negative twenty degrees."
Zhou Peiyao took the test tube and nodded heavily:
"Rest assured, Senior!"
If yesterday’s cyclization experiment was like a Lovecraftian romance, then today’s synthesis experiment is undoubtedly a small healing story.
In its slumber, it was awakened.
The companions around it urged it:
"Hey, hey, it’s time to get up. You haven’t moved at all since the last cycle started."
Oh, it remembered, it was a linear resolve polymerase, not yet encountered its sigma factor.
Though it had just passed Christmas a few days ago, to it, that was just an ordinary night.
Following its companions, it walked and walked, not knowing how much time had passed, it suddenly heard a gentle voice calling.
"Are you... okay?"
It turned its head and saw a beautiful silhouette standing gracefully, smiling like a flower.
For a moment, it didn’t know how to respond and could only say clumsily:
"You... hello."
She was so beautiful, it dared not hope for anything, perhaps she was only asking where the nearest promoter was, as the polymerase there was much stronger in synthesis capacity than it.
"Well... I’m an Oligo primer, accidentally got lost, could you kindly direct me?"
Looking into her eyes, it unthinkingly said:
"Sure."
It gentlemanly linked her binding domain, she shyly consented, and they wandered about the nuclear matrix, counting the beautiful bands on the chromosomes together.
And so it went, unbeknownst for how many cycles.
One day, she suddenly joyfully shook its β-clamp:
"Look there!"
It gazed in the direction her finger pointed, and there was a sequence:
AUGAUACUCUAGGUGGAGUAUUGAUGA
Isn’t that.....
The code of love?
She ran all the way over, gently leaning against the -35 sequence, with a look of enchantment.
Seeing this scene, suddenly, it gathered the courage:
"Um... can you be my girlfriend?"
Her expression suddenly froze, a trace of bitterness rising on her face:
"I am just a primer, I might disappear tomorrow, our union is cursed....."
"It definitely won’t be! We’ll surely be happy forever!"
It hugged her tightly, forcefully prying apart the two tightly bound complementary strands.
She did not resist much, and thus, they embarked on a journey of love.
Everything went smoothly. It looked at the messenger strand continually extending behind, glanced back at the most adorable her, and felt a surge of desire to protect her for a lifetime.
Having such a lovely girl accompany for life, what a blessing in three lifetimes!
And so, more time passed.
However, one day, an unexpected incident occurred.
The temperature of this world suddenly began to drop, a vast amount of matter began to wither, freeze, even die.
It used all its strength to wrap tightly around her, but with a jolt, the structural domain binding them together suddenly loosened!
It shouted out in a heart-wrenching voice:
"Hold on to me, don’t let go! I’ll think of something!"
Trembling, she responded helplessly, with despair and tears:
"It’s useless, I can’t do it!"
After a swirl of current, she drifted further and further away from it.
"Complete the synthesis of our messenger chain, I will love you forever!"
Her tiny figure slowly faded out of its sight, disappearing into the cold nucleoplasm.
It desperately cried to the sky, cursing the injustice of fate.
But the road that needs to be walked must still be traveled, it’s just now it is alone.
It laboriously opened up the glued double strands, placing the nucleotides one by one, each base representing its deep longing for her.
Yet gradually, it too felt exhaustion.
The surrounding electrons continuously attacked its core protein, its subunits gradually loosened, and most alarmingly, at some point, a short ubiquitin chain extended behind it.
It understood that its life was about to reach its end.
In its dying moments, her smiling face flickered in its mind.
So, I’ve always missed her so much, so, I’ve always loved her deeply.
Then, dragging its broken body, it slowly walked and walked until it finally arrived outside a deep pit.
At this moment, lying in the deep pit were countless polymerases like it, from the double strands it was not difficult to see, they too had once met their ’her’.
It laboriously moved to a corner, gazing unfocused at the sky:
"Could it be that the union of primers is destined to have no result?"
In a blur, her three-dimensional structure appeared in front of it, she seemed to be smiling at it, opening her arms...
Just at the thousandth of a second before its consciousness was about to disperse, suddenly in its peripheral vision, there appeared a big and small two figures:
It was a similar kind to it, without a partner beside it, but on one of its strands, a beautifully carved little girl was gingerly holding on.
"That is... that is....."
Its breath suddenly became rapid.
Actually, it was not just it, almost at an instant, due to the tio guidance effect, every ’it’ in the deep pit noticed the incoming one.
"Dear, did you see that?!"
Using the last bit of strength it had, it smiled:
"So... our love was never cursed..."
At the same time.
Looking at the very tiny red dot in the RPKM value heat, Xu Yun felt a bit inexplicably melancholic:
"The fourth generation... finally broke through."
novelraw